IdentifiantMot de passe
Loading...
Mot de passe oublié ?Je m'inscris ! (gratuit)
Téléchargé 1 fois
Vote des utilisateurs
0 
0 
Détails
Licence : Freeware
Mise en ligne le 31 mai 2011
Plate-formes : Linux, Mac, Windows
Langue : Français
Référencé dans
Navigation

Comment récupérer (proprement) les séquences d'un fichier fasta ?

Le but est de récupérer les identifiants et leur séquence une à une de façon simple et rapide grâce au module Bio::SeqIO. Fichier d'entrées :
test.txt

>A1
GATACCAGCATCGTACGTCGTACGTACGTAGGGATCATTATGCCACATTCTGATCTTGGACCTGCATTATAGATCTGACTT
>A2
TACCACCCGATCTCGCATCGTCATGTGCGGGATCATTATGCACATTCTGATCTTGGACCTGCATTATAGATCTGACTT
>B1
GATACCAGCGGGATCATTATGCCACATTCTGATCTTGGACCTGATAGATCTGACT
>B2
GATACCAGCCACTTCTGACGATCGATCGATATTATAAAAGGATCATTATGCCACATTCTGATCgTGGACCTGCATTATAGATCTGCCCTT
>C1
GATACCAGCGGGATCATTATGCCACATTCTGATCTTGGACCTGCATTATAGATCTGACTT
>C2
GATACCAGCGGGATCCTTATGCCACATTCTGATCTTGGACCTGCATTATAGATCTGACTT

Résultat

>A1
GATACCAGCATCGTACGTCGTACGTACGTAGGGATCATTATGCCACATTCTGATCTTGGA
CCTGCATTATAGATCTGACTT
>A2
TACCACCCGATCTCGCATCGTCATGTGCGGGATCATTATGCACATTCTGATCTTGGACCT
GCATTATAGATCTGACTT
>B1
GATACCAGCGGGATCATTATGCCACATTCTGATCTTGGACCTGATAGATCTGACT
>B2
GATACCAGCCACTTCTGACGATCGATCGATATTATAAAAGGATCATTATGCCACATTCTG
ATCgTGGACCTGCATTATAGATCTGCCCTT
>C1
GATACCAGCGGGATCATTATGCCACATTCTGATCTTGGACCTGCATTATAGATCTGACTT
>C2
GATACCAGCGGGATCCTTATGCCACATTCTGATCTTGGACCTGCATTATAGATCTGACTT
Developpez.com décline toute responsabilité quant à l'utilisation des différents éléments téléchargés.