Comment récupérer (proprement) les séquences d'un fichier fasta ?

Présentation
Le but est de récupérer les identifiants et leur séquence une à une de façon simple et rapide grâce au module Bio::SeqIO. Fichier d'entrées :
test.txt

>A1
GATACCAGCATCGTACGTCGTACGTACGTAGGGATCATTATGCCACATTCTGATCTTGGACCTGCATTATAGATCTGACTT
>A2
TACCACCCGATCTCGCATCGTCATGTGCGGGATCATTATGCACATTCTGATCTTGGACCTGCATTATAGATCTGACTT
>B1
GATACCAGCGGGATCATTATGCCACATTCTGATCTTGGACCTGATAGATCTGACT
>B2
GATACCAGCCACTTCTGACGATCGATCGATATTATAAAAGGATCATTATGCCACATTCTGATCgTGGACCTGCATTATAGATCTGCCCTT
>C1
GATACCAGCGGGATCATTATGCCACATTCTGATCTTGGACCTGCATTATAGATCTGACTT
>C2
GATACCAGCGGGATCCTTATGCCACATTCTGATCTTGGACCTGCATTATAGATCTGACTT

Résultat

>A1
GATACCAGCATCGTACGTCGTACGTACGTAGGGATCATTATGCCACATTCTGATCTTGGA
CCTGCATTATAGATCTGACTT
>A2
TACCACCCGATCTCGCATCGTCATGTGCGGGATCATTATGCACATTCTGATCTTGGACCT
GCATTATAGATCTGACTT
>B1
GATACCAGCGGGATCATTATGCCACATTCTGATCTTGGACCTGATAGATCTGACT
>B2
GATACCAGCCACTTCTGACGATCGATCGATATTATAAAAGGATCATTATGCCACATTCTG
ATCgTGGACCTGCATTATAGATCTGCCCTT
>C1
GATACCAGCGGGATCATTATGCCACATTCTGATCTTGGACCTGCATTATAGATCTGACTT
>C2
GATACCAGCGGGATCCTTATGCCACATTCTGATCTTGGACCTGCATTATAGATCTGACTT
Détails
Catégories : Bioinformatique
Avatar de Jasmine80
Membre émérite
Voir tous les téléchargements de l'auteur
Licence : Gratuit
Date de mise en ligne : 31 mai 2011




Developpez.com décline toute responsabilité quant à l'utilisation des différents éléments téléchargés.
Responsable bénévole de la rubrique Perl : djibril -