Ajouter

Tous les téléchargements de Jasmine80

    Comment récupérer (proprement) les séquences d'un fichier fasta ?

    Licence : Freeware - 31/05/2011 - Téléchargé x
    Le but est de récupérer les identifiants et leur séquence une à une de façon simple et rapide grâce au module Bio::SeqIO. Fichier d'entrées :
    test.txt

    >A1
    GATACCAGCATCGTACGTCGTACGTACGTAGGGATCATTATGCCACATTCTGATCTTGGACCTGCATTATAGATCTGACTT
    >A2
    TACCACCCGATCTCGCATCGTCATGTGCGGGATCATTATGCACATTCTGATCTTGGACCTGCATTATAGATCTGACTT
    >B1
    GATACCAGCGGGATCATTATGCCACATTCTGATCTTGGACCTGATAGATCTGACT
    >B2
    GATACCAGCCACTTCTGACGATCGATCGATATTATAAAAGGATCATTATGCCACATTCTGATCgTGGACCTGCATTATAGATCTGCCCTT
    >C1
    GATACCAGCGGGATCATTATGCCACATTCTGATCTTGGACCTGCATTATAGATCTGACTT
    >C2
    GATACCAGCGGGATCCTTATGCCACATTCTGATCTTGGACCTGCATTATAGATCTGACTT

    Résultat

    >A1
    GATACCAGCATCGTACGTCGTACGTACGTAGGGA ... Voir la suite

    Est-il possible de récupérer des sous-séquences d'un alignement ?

    Licence : Freeware - 31/05/2011 - Téléchargé x
    Le module Bio::AlignIO permet de récupérer et d'analyser les séquences une à une en gardant les positions des gaps. On peut donc aussi récupérer un bloc de sous-séquences en gardant leur alignement, mais également obtenir la séquence consensuelle de cet alignement.

    file.fsa

    >A1/1-60
    GATACCAGCGGGATCATTATGCCACATTCTGATCTTGGACCTGCATTATAGATCTGACTT
    .
    >A2/1-57
    ..TACCAGCGGGATCATTATGC.ACATTCTGATCTTGGACCTGCATTATAGATCTGACTT
    .
    >B1/1-55
    GATACCAGCGGGATCATTATGCCACATTCTGATCTTGGACCTG....ATAGATCTGACT.
    .
    >C1/1-60
    GATACCAGCGGGATCATTATGCCACATTCTGATCTTGGACCTGCATTATAGATCTGACTT
    .
    >C2/1-60
    GATACCAGCGGGATCCTTATGCCACATTCTGATCTTGGACCTGCATTATAGATCTGACTT
    .
    >B2/1-61
    GAT ... Voir la suite