Developpez.com

Plus de 2 000 forums
et jusqu'à 5 000 nouveaux messages par jour

Perl

Retrouvez ici tous les meilleurs téléchargements Perl
Ajouter un nouvel élément

    Notepad++

    Éditeur : Don HO +
    Notepad++ est un éditeur de source avec mise en relief de la syntaxe et mise en forme de cette dernière. Ce logiciel vous permet également de colorer les mots définis par l'utilisateur. Vous pouvez ainsi imprimer votre code source en couleur. De plus, Notepad++ possède une fonction multi-vues qui permet à l'utilisateur d'éditer différents documents à la fois et même d'éditer le même document en synchronisant 2 vues différentes. Il supporte entièrement le glisser-déposer: vous pouvez déposer le fichier pour l'ouvrir mais également glisser et visionner un document d'une vue à une autre. Enfin, ce logiciel fonctionne aussi vite que le bloc-notes fourni par MS Windows.

    KanDeLa (dentelle)

    Licence : Gratuit - 09/02/2012 - Téléchargé 15 x
    KanDeLa est un programme qui est destiné à l'élaboration de dessin technique pour la dentelle aux fuseaux et qui permet de générer le piqué correspondant. Il est actuellement orienté pour la dentelle au fuseau du type "torchon".

    Ce programme a été développé dans le but de faciliter des patrons que je désirais réaliser moi-même.

    Ayant dessiné le signet "Chloé" à la main,

    jEdit

    Éditeur : Équipe jEdit +
    jEdit est un éditeur de texte adapté aux développements en tout genre.

    En effet, l'application est capable de mettre en évidence le code de plus d'une centaine de langages dont CSS, ASP, HTML, XML, PHP, Perl, JavaScript, AppleScript, ActionScript, C, C++, Java, Objective C, etc. jEdit permet d'annuler ou de refaire un nombre illimité d'actions. Les fonctionnalités du logiciel peuvent être améliorées grâce à l'installation de plugins. jEdit étant développé sur l'ensemble des plateformes, vous pourrez l'utiliser quelque soit votre environnement de travail.

    Komodo

    Éditeur : ActiveState +
    Issu du logiciel non libre Komodo IDE, cet environnement de développement intégré contient tout ce que l’on peut attendre d’un environnement de développement.

    Critique de JakoJako
    Dernière version disponible, j'ai téléchargé la version d'évaluation.
    Atouts: interface beaucoup plus intuitive (pour moi) et claire qu'Eclipse qui est une vraie usine à gaz. Notion de projet. Possibilité d'avoir des watch, des breakpoints actifs ou inactifs (qui sont conservés même quand on ferme l'EDI). Affichage sympa avec possibilité d'avoir des lignes verticales pour indiquer les { et } correspondants. Editeur pratique et intuitif. A priori, possibilité de reformatage du t ... Voir la suite

    Perl Builder

    Éditeur : Perl Builder +
    Perl Builder 2.0 est un environnement de développement intégré complet pour Perl, il fonctionne sur Windows 9x/NT/2000/XP ou plus.

    Comment récupérer (proprement) les séquences d'un fichier fasta ?

    Licence : Gratuit - 31/05/2011 - Téléchargé 6 x
    Le but est de récupérer les identifiants et leur séquence une à une de façon simple et rapide grâce au module Bio::SeqIO. Fichier d'entrées :
    test.txt

    >A1
    GATACCAGCATCGTACGTCGTACGTACGTAGGGATCATTATGCCACATTCTGATCTTGGACCTGCATTATAGATCTGACTT
    >A2
    TACCACCCGATCTCGCATCGTCATGTGCGGGATCATTATGCACATTCTGATCTTGGACCTGCATTATAGATCTGACTT
    >B1
    GATACCAGCGGGATCATTATGCCACATTCTGATCTTGGACCTGATAGATCTGACT
    >B2
    GATACCAGCCACTTCTGACGATCGATCGATATTATAAAAGGATCATTATGCCACATTCTGATCgTGGACCTGCATTATAGATCTGCCCTT
    >C1
    GATACCAGCGGGATCATTATGCCACATTCTGATCTTGGACCTGCATTATAGATCTGACTT
    >C2
    GATACCAGCGGGATCCTTATGCCACATTCTGATCTTGGACCTGCATTATAGATCTGACTT

    Résultat

    >A1
    GATACCAGCATCGTACGTCGTACGTACGTAGGGA ... Voir la suite

    Fraise

    Éditeur : Fraise +
    Fraise est basé sur l'éditeur de texte Smultron, dont le créateur a décidé d’arrêter le développement.
    Fraise est toujours gratuit et compatible Mac OS 10.6+.

    BioEdit

    Éditeur : BioEdit +
    BioEdit est un éditeur d'alignement des séquences biologiques écrites pour Windows. Une interface intuitive de documents multiples avec des fonctions pratiques rend l'alignement et la manipulation des séquences relativement facile sur votre ordinateur de bureau.

    Qu'en pensez-vous ?

    Emacs

    Éditeur : GNU +
    GNU/Emacs est un éditeur très polyvalent : édition de code, CVS, lecture d'email, édition d'image, etc. On peut mettre son code en ligne par FTP en appelant une simple commande (ou shortcut).

    Pour l'édition du code, il possède de nombreux "modes" : C, C++, HTML, Java, qui vont adapter le fonctionnement d'Emacs. Il possède énormément de fonctions, couramment utilisées (en programmation ) : Recheche/remplacement (supporte les expressions régulières ), Indentation automatique du code (customisable), Coloration syntaxique, (Re)définition des raccourcis claviers "à chaud", Auto-complétion, Gestion du multifenêtrage, Permet de "cacher" le code d'une fonction (affiche uniquement la définition), gestion de macros et de scripts permettant ... Voir la suite

    UltraEdit

    UltraEdit est un excellent remplaçant pour Notepad et beaucoup d'autres éditeurs de texte. Il supporte des fichiers de taille illimitée et possède un vérificateur orthographique contenant plus de 100 000 mots. De plus, l'application permet d'éditer en hexadécimal ou en colonnes. UltraEdit dispose d'une coloration syntaxique configurable, directement utilisable par les programmeurs.

    Comment fusionner plusieurs classeurs Excel d'un répertoire en un unique fichier ?

    Licence : Gratuit - 31/05/2011 - Téléchargé 4 x
    Ce code vous permettra de fusionner plusieurs classeur Excel (xls, xlsx) en un unique fichier Excel (xls). Il copie toutes les feuilles des différents classeurs dans un seul fichier. Le seul inconvénient est qu'il ne garde pas les noms des feuilles mais en génère automatiquement (feuille1, 2, 3, ...) et les formats des cellules ne sont pas conservés.

    Vous aurez besoin d'installer les modules

    Spreadsheet::ParseExcel
    Spreadsheet::XLSX
    Spreadsheet::WriteExcel

    Les modules Getopt::Long et Pod::Usage sont dans le core de Perl.



    Pour savoir comment lancer le programme, faites

    perl nom_programme.pl -help

    ou

    perl nom_programme.pl -man

    Open Perl IDE

    Éditeur : OpenPerlIDE +
    Open Perl IDE est un environnement de développement intégré pour écrire et déboguer des scripts Perl

    Vérification de date de création d'un fichier et suppression si vieux d'un mois.

    Licence : Autre - 28/08/2012 - Téléchargé 2 x
    Ce script va permettre de lister des fichiers dans un dossier.
    Il va ensuite récupèrer les dates de création du fichier, formater le format de la date.
    Les dates seront ensuite comparées à la date actuelle.
    Les fichiers vieux d'un mois seront supprimés.

    NEdit

    Éditeur : nedit.org +
    NEdit, le "Nirvana editor", est un éditeur de code pour le système X Window. Il a une interface comparable aux éditeurs de texte sur Windows et Mac. Initiallement il a été développé par Mark Edel pour Fermilab sous une licence très restrictive, mais aujourd'hui il est distriblé sous licence GPL.

    PSPad

    Éditeur : PSPad +
    PSPad est un éditeur de texte et de code, qui permet de gérer plusieurs projets, pour différentes plateformes. Cette application comporte des outils nécessaires dans la réalisation de scripts, dans le traitement des lignes, dans les conversions, compilations et compressions, etc. Un éditeur Hexadécimal, un moteur de recherche et des filtres font partie des nombreuses options du programme, ainsi que l'insertion de caractères spéciaux, l'auto-correction, la comparaison de textes ...

    Critique de stoyak
    PSPad est très convivial, avec de nombreuses options. Il est également compatible avec d'autres langages. Il y a peu de désavantages pour l'utilisation quotidienne ... Voir la suite

    SciTE

    Éditeur : SciTE +
    SciTE est un éditeur de texte graphique, gratuit et open source fonctionnant sous les environnements Linux et Windows. SciTE est l'acronyme de Scintilla Text Editor, Scintilla étant une plateforme d'édition de texte qui propose par exemple des outils spécifiques pour corriger du code écrit avec SciTE

    Critique de jedai
    C'est vraiment une petite merveille, et tout léger, customisable à souhait, etc...
    Pour ce qui est de la complétion du code et de l'aide en ligne pour Perl, il suffit de disposer du fichier d'API de Perl qui est disponible sur le site officiel et dans certaines distributions du soft pour Windows directement.

    Anjuta

    Éditeur : Anjuta Team +
    Anjuta est un IDE (les fonctionnalités RAD intégrant Glade sont en cour de développement) pour Linux développé dans le cadre du projet Gnome et par conséquent, il est particulièrement intéressant pour les développements en C avec GTK+ (coloration syntaxique des mots clés de GTK+) mais il peut aussi être utilisé pour le développement en C++ avec gtkmm.

    Convertir un code couleur RGB ou RVB en hexadécimal en Perl

    Licence : Gratuit - 20/05/2013 - Téléchargé 2 x
    Voici un code Perl qui permet de convertir un code RVB ou RGB (pour les anglais) en hexadécimal 6-digits.

    Convertir un code couleur hexadécimal en RVB ou RGB en Perl

    Licence : Gratuit - 23/04/2014 - Téléchargé 2 x
    Voici un code Perl qui permet de convertir un code hexadécimal 3-digits ou 6-digits en code RVB ou RGB (pour les anglais).

    AutoDimer

    Éditeur : +
    AutoDimer permet de développer les PCR multiplex et des dosages d'extension d'amorces

74 éléments

Responsable bénévole de la rubrique Perl : djibril -