Perl

Retrouvez ici tous les meilleurs téléchargements Perl
Ajouter un nouvel élément

    Notepad++

    Éditeur : Don HO +
    Notepad++ est un éditeur de source avec mise en relief de la syntaxe et mise en forme de cette dernière. Ce logiciel vous permet également de colorer les mots définis par l'utilisateur. Vous pouvez ainsi imprimer votre code source en couleur. De plus, Notepad++ possède une fonction multi-vues qui permet à l'utilisateur d'éditer différents documents à la fois et même d'éditer le même document en synchronisant 2 vues différentes. Il supporte entièrement le glisser-déposer: vous pouvez déposer le fichier pour l'ouvrir mais également glisser et visionner un document d'une vue à une autre. Enfin, ce logiciel fonctionne aussi vite que le bloc-notes fourni par MS Windows.

    KanDeLa (dentelle)

    Licence : Gratuit - 09/02/2012 - Téléchargé 10 x
    KanDeLa est un programme qui est destiné à l'élaboration de dessin technique pour la dentelle aux fuseaux et qui permet de générer le piqué correspondant. Il est actuellement orienté pour la dentelle au fuseau du type "torchon".

    Ce programme a été développé dans le but de faciliter des patrons que je désirais réaliser moi-même.

    Ayant dessiné le signet "Chloé" à la main,

    NEdit

    Éditeur : nedit.org +
    NEdit, le "Nirvana editor", est un éditeur de code pour le système X Window. Il a une interface comparable aux éditeurs de texte sur Windows et Mac. Initiallement il a été développé par Mark Edel pour Fermilab sous une licence très restrictive, mais aujourd'hui il est distriblé sous licence GPL.

    jEdit

    Éditeur : Équipe jEdit +
    jEdit est un éditeur de texte adapté aux développements en tout genre.

    En effet, l'application est capable de mettre en évidence le code de plus d'une centaine de langages dont CSS, ASP, HTML, XML, PHP, Perl, JavaScript, AppleScript, ActionScript, C, C++, Java, Objective C, etc. jEdit permet d'annuler ou de refaire un nombre illimité d'actions. Les fonctionnalités du logiciel peuvent être améliorées grâce à l'installation de plugins. jEdit étant développé sur l'ensemble des plateformes, vous pourrez l'utiliser quelque soit votre environnement de travail.

    UltraEdit

    UltraEdit est un excellent remplaçant pour Notepad et beaucoup d'autres éditeurs de texte. Il supporte des fichiers de taille illimitée et possède un vérificateur orthographique contenant plus de 100 000 mots. De plus, l'application permet d'éditer en hexadécimal ou en colonnes. UltraEdit dispose d'une coloration syntaxique configurable, directement utilisable par les programmeurs.

    TigrMeV

    Éditeur : TigrMeV +
    Pour l'analyse de données transcriptomiques, je conseille TigrMeV !!! Pas forcément le plus intuitif au départ, les fichiers doivent être formatés le plus souvent avant import, mais il est quand même bien utile !

    Komodo

    Éditeur : ActiveState +
    Issu du logiciel non libre Komodo IDE, cet environnement de développement intégré contient tout ce que l’on peut attendre d’un environnement de développement.

    Critique de JakoJako
    Dernière version disponible, j'ai téléchargé la version d'évaluation.
    Atouts: interface beaucoup plus intuitive (pour moi) et claire qu'Eclipse qui est une vraie usine à gaz. Notion de projet. Possibilité d'avoir des watch, des breakpoints actifs ou inactifs (qui sont conservés même quand on ferme l'EDI). Affichage sympa avec possibilité d'avoir des lignes verticales pour indiquer les { et } correspondants. Editeur pratique et intuitif. A priori, possibilité de reformatage du t ... Voir la suite

    Perl Builder

    Éditeur : Perl Builder +
    Perl Builder 2.0 est un environnement de développement intégré complet pour Perl, il fonctionne sur Windows 9x/NT/2000/XP ou plus.

    Comment encoder le contenu d'une image en code Base64 ?

    Licence : Gratuit - 16/07/2011 - Téléchargé 4 x
    Il est souvent très utile de convertir un fichier, notamment une image png, gif... en une chaine encodée en Base64. Cela nous permet souvent d'insérer cette chaine dans un programme afin d'éviter d'avoir un fichier à part.

    Le code que je vous propose prend en argument une ou plusieurs images et crée un ou plusieurs fichiers txt avec l'extension _base64.txt.

    USAGE : perl C:\test.pl -i image1.gif -i image2.png ...

    Résultat : image1_Base64.txt image2_Base64.txt

    Comment fusionner plusieurs classeurs Excel d'un répertoire en un unique fichier ?

    Licence : Gratuit - 31/05/2011 - Téléchargé 3 x
    Ce code vous permettra de fusionner plusieurs classeur Excel (xls, xlsx) en un unique fichier Excel (xls). Il copie toutes les feuilles des différents classeurs dans un seul fichier. Le seul inconvénient est qu'il ne garde pas les noms des feuilles mais en génère automatiquement (feuille1, 2, 3, ...) et les formats des cellules ne sont pas conservés.

    Vous aurez besoin d'installer les modules

    Spreadsheet::ParseExcel
    Spreadsheet::XLSX
    Spreadsheet::WriteExcel

    Les modules Getopt::Long et Pod::Usage sont dans le core de Perl.



    Pour savoir comment lancer le programme, faites

    perl nom_programme.pl -help

    ou

    perl nom_programme.pl -man

    Comment connaitre le nom et l'ip d'une machine en perl ?

    Licence : Gratuit - 31/05/2011 - Téléchargé 3 x
    Pas de secret, le CPAN contient ce qu'il faut. Utilisez les modules Sys::Hostname et Socket déjà présent dans le CORE de perl.

    Open Perl IDE

    Éditeur : OpenPerlIDE +
    Open Perl IDE est un environnement de développement intégré pour écrire et déboguer des scripts Perl

    SciTE

    Éditeur : SciTE +
    SciTE est un éditeur de texte graphique, gratuit et open source fonctionnant sous les environnements Linux et Windows. SciTE est l'acronyme de Scintilla Text Editor, Scintilla étant une plateforme d'édition de texte qui propose par exemple des outils spécifiques pour corriger du code écrit avec SciTE

    Critique de jedai
    C'est vraiment une petite merveille, et tout léger, customisable à souhait, etc...
    Pour ce qui est de la complétion du code et de l'aide en ligne pour Perl, il suffit de disposer du fichier d'API de Perl qui est disponible sur le site officiel et dans certaines distributions du soft pour Windows directement.

    Anjuta

    Éditeur : Anjuta Team +
    Anjuta est un IDE (les fonctionnalités RAD intégrant Glade sont en cour de développement) pour Linux développé dans le cadre du projet Gnome et par conséquent, il est particulièrement intéressant pour les développements en C avec GTK+ (coloration syntaxique des mots clés de GTK+) mais il peut aussi être utilisé pour le développement en C++ avec gtkmm.

    Fraise

    Éditeur : Fraise +
    Fraise est basé sur l'éditeur de texte Smultron, dont le créateur a décidé d’arrêter le développement.
    Fraise est toujours gratuit et compatible Mac OS 10.6+.

    Comment fusionner plusieurs fichier "csv" en un fichier Excel avec onglets ?

    Licence : Autre - 29/11/2011 - Téléchargé 2 x
    J'ai cherché sur internet pour faire cela mais sans succès. J'ai adapté ce que j'ai trouvé ici et là pour faire ce petit script (Je suis niveau débutant)

    Vim

    Éditeur : vim +
    Vim est un éditeur de texte, c'est-à-dire un logiciel permettant la manipulation de fichiers texte. Il est directement inspiré de vi (un éditeur très répandu sur les systèmes d'exploitation de type UNIX), dont il est le clone le plus populaire. Son nom signifie d'ailleurs Vi IMproved, que l'on peut traduire par « VI aMélioré », ou éventuellement « VI Meilleur ».

    Comment récupérer (proprement) les séquences d'un fichier fasta ?

    Licence : Gratuit - 31/05/2011 - Téléchargé 1 x
    Le but est de récupérer les identifiants et leur séquence une à une de façon simple et rapide grâce au module Bio::SeqIO. Fichier d'entrées :
    test.txt

    >A1
    GATACCAGCATCGTACGTCGTACGTACGTAGGGATCATTATGCCACATTCTGATCTTGGACCTGCATTATAGATCTGACTT
    >A2
    TACCACCCGATCTCGCATCGTCATGTGCGGGATCATTATGCACATTCTGATCTTGGACCTGCATTATAGATCTGACTT
    >B1
    GATACCAGCGGGATCATTATGCCACATTCTGATCTTGGACCTGATAGATCTGACT
    >B2
    GATACCAGCCACTTCTGACGATCGATCGATATTATAAAAGGATCATTATGCCACATTCTGATCgTGGACCTGCATTATAGATCTGCCCTT
    >C1
    GATACCAGCGGGATCATTATGCCACATTCTGATCTTGGACCTGCATTATAGATCTGACTT
    >C2
    GATACCAGCGGGATCCTTATGCCACATTCTGATCTTGGACCTGCATTATAGATCTGACTT

    Résultat

    >A1
    GATACCAGCATCGTACGTCGTACGTACGTAGGGA ... Voir la suite

    Comment convertir un fichier Excel en fichier csv ou txt ?

    Licence : Gratuit - 31/05/2011 - Téléchargé 1 x
    Le code ci-dessous permet de convertir un fichier excel 2007 (ou antérieur) en fichier txt, csv ou autre fichier plat.

    Le choix du séparateur est laissé à l'utilisateur.
    Si l'on on précise un répertoire, le fichier convertit sera créé dans ce dernier, sinon, il sera créé dans le même répertoire que le fichier excel.
    On peut choisir de convertir toutes les feuilles ou non du fichier excel en mettant -feuilles à 1 => tout sera convertit, ou à 0 et dans ce cas, à chaque feuille une confirmation sera demandée.

    Attention : Nous avons utilisé ici la méthode print {$fh} $oWkC->Value, $Separateur;

    Mais cette méthode peut nous générer des erreurs inattendues :
    explication documentation o ... Voir la suite

    Comment connaitre le time depuis une date ( L'inverse de localtime et gmtime) ?

    Licence : Gratuit - 31/05/2011 - Téléchargé 1 x
    Il peut être utile de connaître le time d'une date, c'est l'inverse de time, localtime et gmtime. Cela se fait par exemple en php pour les connaisseurs via la fonction mktime. Comme d'habitude, il existe un module en Time::Local en perl déjà présent dans le CORE, donc pas besoin d'installation.

    Ce module posséde deux méthodes timelocal et timegm qui renvoient le time. Il faut leur donner 6 informations sous forme de tableau ($sec,$min,$hour,$mday,$mon,$year).

    Attention : $year sera bien l'année classique (avec + 1900), ex : 2007 et $mois sera compris entre 0 et 11 et non entre 1 et 12.

    Nous trouver le time des dates 01/01/2000 et 05/12/2008



    Vous pourrez maintenant jongler avec les tim ... Voir la suite

74 éléments

Responsable bénévole de la rubrique Perl : djibril -