Perl

Retrouvez ici tous les meilleurs téléchargements Perl
Ajouter un nouvel élément

    Notepad++

    Éditeur : Don HO +
    Notepad++ est un éditeur de source avec mise en relief de la syntaxe et mise en forme de cette dernière. Ce logiciel vous permet également de colorer les mots définis par l'utilisateur. Vous pouvez ainsi imprimer votre code source en couleur. De plus, Notepad++ possède une fonction multi-vues qui permet à l'utilisateur d'éditer différents documents à la fois et même d'éditer le même document en synchronisant 2 vues différentes. Il supporte entièrement le glisser-déposer: vous pouvez déposer le fichier pour l'ouvrir mais également glisser et visionner un document d'une vue à une autre. Enfin, ce logiciel fonctionne aussi vite que le bloc-notes fourni par MS Windows.

    Komodo

    Éditeur : ActiveState +
    Issu du logiciel non libre Komodo IDE, cet environnement de développement intégré contient tout ce que l’on peut attendre d’un environnement de développement.

    Critique de JakoJako
    Dernière version disponible, j'ai téléchargé la version d'évaluation.
    Atouts: interface beaucoup plus intuitive (pour moi) et claire qu'Eclipse qui est une vraie usine à gaz. Notion de projet. Possibilité d'avoir des watch, des breakpoints actifs ou inactifs (qui sont conservés même quand on ferme l'EDI). Affichage sympa avec possibilité d'avoir des lignes verticales pour indiquer les { et } correspondants. Editeur pratique et intuitif. A priori, possibilité de reformatage du t ... Voir la suite

    KanDeLa (dentelle)

    Licence : Gratuit - 09/02/2012 - Téléchargé 10 x
    KanDeLa est un programme qui est destiné à l'élaboration de dessin technique pour la dentelle aux fuseaux et qui permet de générer le piqué correspondant. Il est actuellement orienté pour la dentelle au fuseau du type "torchon".

    Ce programme a été développé dans le but de faciliter des patrons que je désirais réaliser moi-même.

    Ayant dessiné le signet "Chloé" à la main,

    UltraEdit

    UltraEdit est un excellent remplaçant pour Notepad et beaucoup d'autres éditeurs de texte. Il supporte des fichiers de taille illimitée et possède un vérificateur orthographique contenant plus de 100 000 mots. De plus, l'application permet d'éditer en hexadécimal ou en colonnes. UltraEdit dispose d'une coloration syntaxique configurable, directement utilisable par les programmeurs.

    Comment convertir un fichier Excel en fichier csv ou txt ?

    Licence : Gratuit - 31/05/2011 - Téléchargé 7 x
    Le code ci-dessous permet de convertir un fichier excel 2007 (ou antérieur) en fichier txt, csv ou autre fichier plat.

    Le choix du séparateur est laissé à l'utilisateur.
    Si l'on on précise un répertoire, le fichier convertit sera créé dans ce dernier, sinon, il sera créé dans le même répertoire que le fichier excel.
    On peut choisir de convertir toutes les feuilles ou non du fichier excel en mettant -feuilles à 1 => tout sera convertit, ou à 0 et dans ce cas, à chaque feuille une confirmation sera demandée.

    Attention : Nous avons utilisé ici la méthode print {$fh} $oWkC->Value, $Separateur;

    Mais cette méthode peut nous générer des erreurs inattendues :
    explication documentation o ... Voir la suite

    jEdit

    Éditeur : Équipe jEdit +
    jEdit est un éditeur de texte adapté aux développements en tout genre.

    En effet, l'application est capable de mettre en évidence le code de plus d'une centaine de langages dont CSS, ASP, HTML, XML, PHP, Perl, JavaScript, AppleScript, ActionScript, C, C++, Java, Objective C, etc. jEdit permet d'annuler ou de refaire un nombre illimité d'actions. Les fonctionnalités du logiciel peuvent être améliorées grâce à l'installation de plugins. jEdit étant développé sur l'ensemble des plateformes, vous pourrez l'utiliser quelque soit votre environnement de travail.

    NEdit

    Éditeur : NEdit +
    NEdit, le "Nirvana editor", est un éditeur de code pour le système X Window. Il a une interface comparable aux éditeurs de texte sur Windows et Mac. Initiallement il a été développé par Mark Edel pour Fermilab sous une licence très restrictive, mais aujourd'hui il est distriblé sous licence GPL.

    Comment connaitre le nom et l'ip d'une machine en perl ?

    Licence : Gratuit - 31/05/2011 - Téléchargé 2 x
    Pas de secret, le CPAN contient ce qu'il faut. Utilisez les modules Sys::Hostname et Socket déjà présent dans le CORE de perl.

    Padre

    Éditeur : padre +
    Padre est un IDE Perl, un environnement de développement intégré, ou en d'autres termes un éditeur de texte qui est simple à utiliser pour les programmeurs Perl, mais aussi de nouveaux supports de grands projets multi-langue et multi-technologies.

    Notre principal objectif est de créer un environnement incomparable pour l'apprentissage de Perl et de créer des scripts Perl, les modules et les distributions, avec un système de plug-in extensibles pour soutenir l'ajout de fonctionnalités et les langues et pour soutenir les développeurs avancés, prenant l'éditeur où ils veulent qu'il aille.

    Critique djibril :
    Padre est un éditeur de texte très ... Voir la suite

    BioEdit

    Éditeur : BioEdit +
    BioEdit est un éditeur d'alignement des séquences biologiques écrites pour Windows. Une interface intuitive de documents multiples avec des fonctions pratiques rend l'alignement et la manipulation des séquences relativement facile sur votre ordinateur de bureau.

    Qu'en pensez-vous ?

    Convertir un code couleur hexadécimal en RVB ou RGB en Perl

    Licence : Gratuit - 23/04/2014 - Téléchargé 2 x
    Voici un code Perl qui permet de convertir un code hexadécimal 3-digits ou 6-digits en code RVB ou RGB (pour les anglais).

    Anjuta

    Éditeur : Anjuta Team +
    Anjuta est un IDE (les fonctionnalités RAD intégrant Glade sont en cour de développement) pour Linux développé dans le cadre du projet Gnome et par conséquent, il est particulièrement intéressant pour les développements en C avec GTK+ (coloration syntaxique des mots clés de GTK+) mais il peut aussi être utilisé pour le développement en C++ avec gtkmm.

    Emacs

    Éditeur : GNU +
    GNU/Emacs est un éditeur très polyvalent : édition de code, CVS, lecture d'email, édition d'image, etc. On peut mettre son code en ligne par FTP en appelant une simple commande (ou shortcut).

    Pour l'édition du code, il possède de nombreux "modes" : C, C++, HTML, Java, qui vont adapter le fonctionnement d'Emacs. Il possède énormément de fonctions, couramment utilisées (en programmation ) : Recheche/remplacement (supporte les expressions régulières ), Indentation automatique du code (customisable), Coloration syntaxique, (Re)définition des raccourcis claviers "à chaud", Auto-complétion, Gestion du multifenêtrage, Permet de "cacher" le code d'une fonction (affiche uniquement la définition), gestion de macros et de scripts permettant ... Voir la suite

    Vim

    Éditeur : vim +
    Vim est un éditeur de texte, c'est-à-dire un logiciel permettant la manipulation de fichiers texte. Il est directement inspiré de vi (un éditeur très répandu sur les systèmes d'exploitation de type UNIX), dont il est le clone le plus populaire. Son nom signifie d'ailleurs Vi IMproved, que l'on peut traduire par « VI aMélioré », ou éventuellement « VI Meilleur ».

    Comment faire un sleep de moins d'une seconde ?

    Licence : Gratuit - 31/05/2011 - Téléchargé 1 x
    Pour faire un sleep de moins d'une seconde, il est recommandé d'utiliser le module Time::HiRes qui est disponible dans le core.
    Mais vous pouvez être encore beaucoup plus précis. A vous de jouer avec ce module très puissant.

    Comment récupérer (proprement) les séquences d'un fichier fasta ?

    Licence : Gratuit - 31/05/2011 - Téléchargé 1 x
    Le but est de récupérer les identifiants et leur séquence une à une de façon simple et rapide grâce au module Bio::SeqIO. Fichier d'entrées :
    test.txt

    >A1
    GATACCAGCATCGTACGTCGTACGTACGTAGGGATCATTATGCCACATTCTGATCTTGGACCTGCATTATAGATCTGACTT
    >A2
    TACCACCCGATCTCGCATCGTCATGTGCGGGATCATTATGCACATTCTGATCTTGGACCTGCATTATAGATCTGACTT
    >B1
    GATACCAGCGGGATCATTATGCCACATTCTGATCTTGGACCTGATAGATCTGACT
    >B2
    GATACCAGCCACTTCTGACGATCGATCGATATTATAAAAGGATCATTATGCCACATTCTGATCgTGGACCTGCATTATAGATCTGCCCTT
    >C1
    GATACCAGCGGGATCATTATGCCACATTCTGATCTTGGACCTGCATTATAGATCTGACTT
    >C2
    GATACCAGCGGGATCCTTATGCCACATTCTGATCTTGGACCTGCATTATAGATCTGACTT

    Résultat

    >A1
    GATACCAGCATCGTACGTCGTACGTACGTAGGGA ... Voir la suite

    Est-il possible de récupérer des sous-séquences d'un alignement ?

    Licence : Gratuit - 31/05/2011 - Téléchargé 1 x
    Le module Bio::AlignIO permet de récupérer et d'analyser les séquences une à une en gardant les positions des gaps. On peut donc aussi récupérer un bloc de sous-séquences en gardant leur alignement, mais également obtenir la séquence consensuelle de cet alignement.

    file.fsa

    >A1/1-60
    GATACCAGCGGGATCATTATGCCACATTCTGATCTTGGACCTGCATTATAGATCTGACTT
    .
    >A2/1-57
    ..TACCAGCGGGATCATTATGC.ACATTCTGATCTTGGACCTGCATTATAGATCTGACTT
    .
    >B1/1-55
    GATACCAGCGGGATCATTATGCCACATTCTGATCTTGGACCTG....ATAGATCTGACT.
    .
    >C1/1-60
    GATACCAGCGGGATCATTATGCCACATTCTGATCTTGGACCTGCATTATAGATCTGACTT
    .
    >C2/1-60
    GATACCAGCGGGATCCTTATGCCACATTCTGATCTTGGACCTGCATTATAGATCTGACTT
    .
    >B2/1-61
    GAT ... Voir la suite

    Comment trouver le nombre d'occurrence d'un motif dans une chaine ?

    Licence : Gratuit - 31/05/2011 - Téléchargé 1 x
    Il y a 4 "e" dans $phrase

    =()= est ce qu'on appelle en Perl un goatse, pas toujours connu du grand public.

    En fait, c'est l'usage de l'opérateur d'affectation à une liste vide qui permet d'évaluer l'expression régulière dans un contexte de liste et dont le résultat est affecté à $count. Or la valeur de retour d'une affectation de liste évaluée dans un contexte de scalaire retourne le nombre d'élément contenu dans la rvalue de cet opérateur d'affectation, donc le nombre d'élément capturé par l'expression régulière.

    Comment mettre la première lettre de tous les mots d'une chaine en majuscule ou minuscule ?

    Licence : Gratuit - 31/05/2011 - Téléchargé 1 x
    L'utilisation des expressions régulière est plus appropriée.

    Comment fusionner plusieurs classeurs Excel d'un répertoire en un unique fichier ?

    Licence : Gratuit - 31/05/2011 - Téléchargé 1 x
    Ce code vous permettra de fusionner plusieurs classeur Excel (xls, xlsx) en un unique fichier Excel (xls). Il copie toutes les feuilles des différents classeurs dans un seul fichier. Le seul inconvénient est qu'il ne garde pas les noms des feuilles mais en génère automatiquement (feuille1, 2, 3, ...) et les formats des cellules ne sont pas conservés.

    Vous aurez besoin d'installer les modules

    Spreadsheet::ParseExcel
    Spreadsheet::XLSX
    Spreadsheet::WriteExcel

    Les modules Getopt::Long et Pod::Usage sont dans le core de Perl.



    Pour savoir comment lancer le programme, faites

    perl nom_programme.pl -help

    ou

    perl nom_programme.pl -man

74 éléments

Responsable bénévole de la rubrique Perl : djibril -