Perl

Retrouvez ici tous les meilleurs téléchargements Perl
Ajouter un nouvel élément

    Notepad++

    Éditeur : Don HO +
    Notepad++ est un éditeur de source avec mise en relief de la syntaxe et mise en forme de cette dernière. Ce logiciel vous permet également de colorer les mots définis par l'utilisateur. Vous pouvez ainsi imprimer votre code source en couleur. De plus, Notepad++ possède une fonction multi-vues qui permet à l'utilisateur d'éditer différents documents à la fois et même d'éditer le même document en synchronisant 2 vues différentes. Il supporte entièrement le glisser-déposer: vous pouvez déposer le fichier pour l'ouvrir mais également glisser et visionner un document d'une vue à une autre. Enfin, ce logiciel fonctionne aussi vite que le bloc-notes fourni par MS Windows.

    KanDeLa (dentelle)

    Licence : Freeware - 09/02/2012 - Téléchargé 5 x
    KanDeLa est un programme qui est destiné à l'élaboration de dessin technique pour la dentelle aux fuseaux et qui permet de générer le piqué correspondant. Il est actuellement orienté pour la dentelle au fuseau du type "torchon".

    Ce programme a été développé dans le but de faciliter des patrons que je désirais réaliser moi-même.

    Ayant dessiné le signet "Chloé" à la main,

    Komodo

    Éditeur : ActiveState +
    Issu du logiciel non libre Komodo IDE, cet environnement de développement intégré contient tout ce que l’on peut attendre d’un environnement de développement.

    Critique de JakoJako
    Dernière version disponible, j'ai téléchargé la version d'évaluation.
    Atouts: interface beaucoup plus intuitive (pour moi) et claire qu'Eclipse qui est une vraie usine à gaz. Notion de projet. Possibilité d'avoir des watch, des breakpoints actifs ou inactifs (qui sont conservés même quand on ferme l'EDI). Affichage sympa avec possibilité d'avoir des lignes verticales pour indiquer les { et } correspondants. Editeur pratique et intuitif. A priori, possibilité de reformatage du t ... Voir la suite

    Equipe jEdit

    Éditeur : Équipe jEdit +
    jEdit est un éditeur de texte adapté aux développements en tout genre.
    En effet, l'application est capable de mettre en évidence le code de plus d'une centaine de langages dont CSS, ASP, HTML, XML, PHP, Perl, JavaScript, AppleScript, ActionScript, C, C++, Java, Objective C, etc. jEdit permet d'annuler ou de refaire un nombre illimité d'actions. Les fonctionnalités du logiciel peuvent être améliorées grâce à l'installation de plugins. jEdit étant développé sur l'ensemble des plateformes, vous pourrez l'utiliser quelque soit votre environnement de travail.

    Padre

    Éditeur : padre +
    Padre est un IDE Perl, un environnement de développement intégré, ou en d'autres termes un éditeur de texte qui est simple à utiliser pour les programmeurs Perl, mais aussi de nouveaux supports de grands projets multi-langue et multi-technologies.

    Notre principal objectif est de créer un environnement incomparable pour l'apprentissage de Perl et de créer des scripts Perl, les modules et les distributions, avec un système de plug-in extensibles pour soutenir l'ajout de fonctionnalités et les langues et pour soutenir les développeurs avancés, prenant l'éditeur où ils veulent qu'il aille.

    Critique djibril :
    Padre est un éditeur de texte très ... Voir la suite

    UltraEdit

    UltraEdit est un excellent remplaçant pour Notepad et beaucoup d'autres éditeurs de texte. Il supporte des fichiers de taille illimitée et possède un vérificateur orthographique contenant plus de 100 000 mots. De plus, l'application permet d'éditer en hexadécimal ou en colonnes. UltraEdit dispose d'une coloration syntaxique configurable, directement utilisable par les programmeurs.

    Anjuta

    Éditeur : Anjuta Team +
    Anjuta est un IDE (les fonctionnalités RAD intégrant Glade sont en cour de développement) pour Linux développé dans le cadre du projet Gnome et par conséquent, il est particulièrement intéressant pour les développements en C avec GTK+ (coloration syntaxique des mots clés de GTK+) mais il peut aussi être utilisé pour le développement en C++ avec gtkmm.

    Comment mettre la première lettre de tous les mots d'une chaine en majuscule ou minuscule ?

    Licence : Freeware - 31/05/2011 - Téléchargé 1 x
    L'utilisation des expressions régulière est plus appropriée.

    NEdit

    Éditeur : NEdit +
    NEdit, le "Nirvana editor", est un éditeur de code pour le système X Window. Il a une interface comparable aux éditeurs de texte sur Windows et Mac. Initiallement il a été développé par Mark Edel pour Fermilab sous une licence très restrictive, mais aujourd'hui il est distriblé sous licence GPL.

    PSPad

    Éditeur : PSPad +
    PSPad editor est un freeware permettant d'éditer du texte et du code sous Windows.Cette application comporte des outils nécessaires dans la réalisation de scripts, dans le traitement des lignes, dans les conversions, compilations et compressions, etc. Un éditeur Hexadécimal, un moteur de recherche et des filtres font partie des nombreuses options du programme, ainsi que l'insertion de caractères spéciaux, l'auto-correction, la comparaison de textes ...

    SciTE

    Éditeur : SciTE +
    SciTE est un éditeur de texte graphique, gratuit et open source fonctionnant sous les environnements Linux et Windows. SciTE est l'acronyme de Scintilla Text Editor, Scintilla étant une plateforme d'édition de texte qui propose par exemple des outils spécifiques pour corriger du code écrit avec SciTE

    Critique de jedai
    C'est vraiment une petite merveille, et tout léger, customisable à souhait, etc...
    Pour ce qui est de la complétion du code et de l'aide en ligne pour Perl, il suffit de disposer du fichier d'API de Perl qui est disponible sur le site officiel et dans certaines distributions du soft pour Windows directement.

    KDevelop

    Éditeur : Equipe kdevelop +
    KDevelop est un IDE pour Linux qui fait partie de la suite de logiciels proposée par l'environnement de bureau KDE. A l'inverse de Anjuta, il est plutôt axé pour le développement en C++ avec Qt.

    Emacs

    Éditeur : GNU +
    GNU/Emacs est un éditeur très polyvalent : édition de code, CVS, lecture d'email, édition d'image, etc. On peut mettre son code en ligne par FTP en appelant une simple commande (ou shortcut).

    Pour l'édition du code, il possède de nombreux "modes" : C, C++, HTML, Java, qui vont adapter le fonctionnement d'Emacs. Il possède énormément de fonctions, couramment utilisées (en programmation ) : Recheche/remplacement (supporte les expressions régulières ), Indentation automatique du code (customisable), Coloration syntaxique, (Re)définition des raccourcis claviers "à chaud", Auto-complétion, Gestion du multifenêtrage, Permet de "cacher" le code d'une fonction (affiche uniquement la définition), gestion de macros et de scripts permettant ... Voir la suite

    Vim

    Éditeur : vim +
    Vim est un éditeur de texte, c'est-à-dire un logiciel permettant la manipulation de fichiers texte. Il est directement inspiré de vi (un éditeur très répandu sur les systèmes d'exploitation de type UNIX), dont il est le clone le plus populaire. Son nom signifie d'ailleurs Vi IMproved, que l'on peut traduire par « VI aMélioré », ou éventuellement « VI Meilleur ».

    Comment récupérer une page Web ?

    Licence : Freeware - 31/05/2011 - Téléchargé x
    Voici un script permettant de récupérer le contenu d'une page Web et l'afficher sur la sortie standard STDOUT. Il y a la possibilité de spécifier un proxy HTTP. Ainsi qu'un login pour les connexions HTTP (autorisation de base).

    Comment faire un sleep de moins d'une seconde ?

    Licence : Freeware - 31/05/2011 - Téléchargé x
    Pour faire un sleep de moins d'une seconde, il est recommandé d'utiliser le module Time::HiRes qui est disponible dans le core.
    Mais vous pouvez être encore beaucoup plus précis. A vous de jouer avec ce module très puissant.

    Comment désinstaller un module ?

    Licence : Freeware - 31/05/2011 - Téléchargé x
    Sous Linux ou Mac OS, il n'existe aucun utilitaire permettant de désinstaller un module Perl. Donc, voici un script qui peut vous permet de le faire proprement.

    Comment raboter un texte trop long et ajouter 3 petits points ?

    Licence : Freeware - 31/05/2011 - Téléchargé x
    Comment raboter un texte trop long et ajouter 3 petits points ?

    Comment tester la validité d'une adresse électronique ?

    Licence : Freeware - 31/05/2011 - Téléchargé x
    Pour tester la validité d'une adresse électronique, inutile de s'acharner à trouver la bonne expression régulière. Il existe des modules perl le faisant pour nous proprement.

    Voici un exemple de codes utilisant des modules différents Email::Valid et Mail::CheckUser.

    Comment récupérer (proprement) les séquences d'un fichier fasta ?

    Licence : Freeware - 31/05/2011 - Téléchargé x
    Le but est de récupérer les identifiants et leur séquence une à une de façon simple et rapide grâce au module Bio::SeqIO. Fichier d'entrées :
    test.txt

    >A1
    GATACCAGCATCGTACGTCGTACGTACGTAGGGATCATTATGCCACATTCTGATCTTGGACCTGCATTATAGATCTGACTT
    >A2
    TACCACCCGATCTCGCATCGTCATGTGCGGGATCATTATGCACATTCTGATCTTGGACCTGCATTATAGATCTGACTT
    >B1
    GATACCAGCGGGATCATTATGCCACATTCTGATCTTGGACCTGATAGATCTGACT
    >B2
    GATACCAGCCACTTCTGACGATCGATCGATATTATAAAAGGATCATTATGCCACATTCTGATCgTGGACCTGCATTATAGATCTGCCCTT
    >C1
    GATACCAGCGGGATCATTATGCCACATTCTGATCTTGGACCTGCATTATAGATCTGACTT
    >C2
    GATACCAGCGGGATCCTTATGCCACATTCTGATCTTGGACCTGCATTATAGATCTGACTT

    Résultat

    >A1
    GATACCAGCATCGTACGTCGTACGTACGTAGGGA ... Voir la suite

73 éléments