Perl

Retrouvez ici tous les meilleurs téléchargements Perl
Ajouter un nouvel élément

    ED for Windows

    Éditeur : getsoft +
    ED for Windows est un éditeur et un EDI puissant et intelligent. Que vous développiez en Assembleur, C/C++, MATLAB, Progress, PHP, Ruby, VHDL, Cobol, Fortran, Java, Perl, SQL ou un des nombreux autres langages qu'ED supporte, vous serez rapidement impressionné par ses capacités

    Padre

    Éditeur : padre +
    Padre est un IDE Perl, un environnement de développement intégré, ou en d'autres termes un éditeur de texte qui est simple à utiliser pour les programmeurs Perl, mais aussi de nouveaux supports de grands projets multi-langue et multi-technologies.

    Notre principal objectif est de créer un environnement incomparable pour l'apprentissage de Perl et de créer des scripts Perl, les modules et les distributions, avec un système de plug-in extensibles pour soutenir l'ajout de fonctionnalités et les langues et pour soutenir les développeurs avancés, prenant l'éditeur où ils veulent qu'il aille.

    Critique djibril :
    Padre est un éditeur de texte très ... Voir la suite

    Gedit

    Éditeur : GNOME +
    Gedit est l'éditeur de texte officiel de l'environnement GNOME.

    NEdit

    Éditeur : NEdit +
    NEdit, le "Nirvana editor", est un éditeur de code pour le système X Window. Il a une interface comparable aux éditeurs de texte sur Windows et Mac. Initiallement il a été développé par Mark Edel pour Fermilab sous une licence très restrictive, mais aujourd'hui il est distriblé sous licence GPL.

    Fraise

    Éditeur : Fraise +
    Fraise est basé sur l'éditeur de texte Smultron, dont le créateur a décidé d’arrêter le développement.
    Fraise est toujours gratuit et compatible Mac OS 10.6+.

    Comment fusionner plusieurs fichier "csv" en un fichier Excel avec onglets ?

    Licence : Autre - 29/11/2011 - Téléchargé 1 x
    J'ai cherché sur internet pour faire cela mais sans succès. J'ai adapté ce que j'ai trouvé ici et là pour faire ce petit script (Je suis niveau débutant)

    Emacs

    Éditeur : GNU +
    GNU/Emacs est un éditeur très polyvalent : édition de code, CVS, lecture d'email, édition d'image, etc. On peut mettre son code en ligne par FTP en appelant une simple commande (ou shortcut).

    Pour l'édition du code, il possède de nombreux "modes" : C, C++, HTML, Java, qui vont adapter le fonctionnement d'Emacs. Il possède énormément de fonctions, couramment utilisées (en programmation ) : Recheche/remplacement (supporte les expressions régulières ), Indentation automatique du code (customisable), Coloration syntaxique, (Re)définition des raccourcis claviers "à chaud", Auto-complétion, Gestion du multifenêtrage, Permet de "cacher" le code d'une fonction (affiche uniquement la définition), gestion de macros et de scripts permettant ... Voir la suite

    Vim

    Éditeur : vim +
    Vim est un éditeur de texte, c'est-à-dire un logiciel permettant la manipulation de fichiers texte. Il est directement inspiré de vi (un éditeur très répandu sur les systèmes d'exploitation de type UNIX), dont il est le clone le plus populaire. Son nom signifie d'ailleurs Vi IMproved, que l'on peut traduire par « VI aMélioré », ou éventuellement « VI Meilleur ».

    Comment récupérer une page Web ?

    Licence : Gratuit - 31/05/2011 - Téléchargé x
    Voici un script permettant de récupérer le contenu d'une page Web et l'afficher sur la sortie standard STDOUT. Il y a la possibilité de spécifier un proxy HTTP. Ainsi qu'un login pour les connexions HTTP (autorisation de base).

    Comment désinstaller un module ?

    Licence : Gratuit - 31/05/2011 - Téléchargé x
    Sous Linux ou Mac OS, il n'existe aucun utilitaire permettant de désinstaller un module Perl. Donc, voici un script qui peut vous permet de le faire proprement.

    Comment raboter un texte trop long et ajouter 3 petits points ?

    Licence : Gratuit - 31/05/2011 - Téléchargé x
    Comment raboter un texte trop long et ajouter 3 petits points ?

    Comment tester la validité d'une adresse électronique ?

    Licence : Gratuit - 31/05/2011 - Téléchargé x
    Pour tester la validité d'une adresse électronique, inutile de s'acharner à trouver la bonne expression régulière. Il existe des modules perl le faisant pour nous proprement.

    Voici un exemple de codes utilisant des modules différents Email::Valid et Mail::CheckUser.

    Comment récupérer (proprement) les séquences d'un fichier fasta ?

    Licence : Gratuit - 31/05/2011 - Téléchargé x
    Le but est de récupérer les identifiants et leur séquence une à une de façon simple et rapide grâce au module Bio::SeqIO. Fichier d'entrées :
    test.txt

    >A1
    GATACCAGCATCGTACGTCGTACGTACGTAGGGATCATTATGCCACATTCTGATCTTGGACCTGCATTATAGATCTGACTT
    >A2
    TACCACCCGATCTCGCATCGTCATGTGCGGGATCATTATGCACATTCTGATCTTGGACCTGCATTATAGATCTGACTT
    >B1
    GATACCAGCGGGATCATTATGCCACATTCTGATCTTGGACCTGATAGATCTGACT
    >B2
    GATACCAGCCACTTCTGACGATCGATCGATATTATAAAAGGATCATTATGCCACATTCTGATCgTGGACCTGCATTATAGATCTGCCCTT
    >C1
    GATACCAGCGGGATCATTATGCCACATTCTGATCTTGGACCTGCATTATAGATCTGACTT
    >C2
    GATACCAGCGGGATCCTTATGCCACATTCTGATCTTGGACCTGCATTATAGATCTGACTT

    Résultat

    >A1
    GATACCAGCATCGTACGTCGTACGTACGTAGGGA ... Voir la suite

    Est-il possible de récupérer des sous-séquences d'un alignement ?

    Licence : Gratuit - 31/05/2011 - Téléchargé x
    Le module Bio::AlignIO permet de récupérer et d'analyser les séquences une à une en gardant les positions des gaps. On peut donc aussi récupérer un bloc de sous-séquences en gardant leur alignement, mais également obtenir la séquence consensuelle de cet alignement.

    file.fsa

    >A1/1-60
    GATACCAGCGGGATCATTATGCCACATTCTGATCTTGGACCTGCATTATAGATCTGACTT
    .
    >A2/1-57
    ..TACCAGCGGGATCATTATGC.ACATTCTGATCTTGGACCTGCATTATAGATCTGACTT
    .
    >B1/1-55
    GATACCAGCGGGATCATTATGCCACATTCTGATCTTGGACCTG....ATAGATCTGACT.
    .
    >C1/1-60
    GATACCAGCGGGATCATTATGCCACATTCTGATCTTGGACCTGCATTATAGATCTGACTT
    .
    >C2/1-60
    GATACCAGCGGGATCCTTATGCCACATTCTGATCTTGGACCTGCATTATAGATCTGACTT
    .
    >B2/1-61
    GAT ... Voir la suite

    Comment trouver le nombre d'occurrence d'un motif dans une chaine ?

    Licence : Gratuit - 31/05/2011 - Téléchargé x
    Il y a 4 "e" dans $phrase

    =()= est ce qu'on appelle en Perl un goatse, pas toujours connu du grand public.

    En fait, c'est l'usage de l'opérateur d'affectation à une liste vide qui permet d'évaluer l'expression régulière dans un contexte de liste et dont le résultat est affecté à $count. Or la valeur de retour d'une affectation de liste évaluée dans un contexte de scalaire retourne le nombre d'élément contenu dans la rvalue de cet opérateur d'affectation, donc le nombre d'élément capturé par l'expression régulière.

    Comment mettre la première lettre de tous les mots d'une chaine en majuscule ou minuscule ?

    Licence : Gratuit - 31/05/2011 - Téléchargé x
    L'utilisation des expressions régulière est plus appropriée.

    Comment transposer un fichier tabulé ?

    Licence : Gratuit - 31/05/2011 - Téléchargé x
    Si vous souhaitez transposer un fichier tabulé, c'est à dire que les lignes de votre fichier deviennent des colonnes, voici une procédure qui peut vous aider.

    Comment récupérer une date aléatoire entre deux dates données ?

    Licence : Gratuit - 31/05/2011 - Téléchargé x
    Comme DateTime est le module préconisé, mais qu'il n'est pas disponible dans le Core, alors que POSIX l'est, il me semble que c'est une bonne alternative pour des utilisations "limitées".

    Le code ci-dessous est compatible avec des machines acceptant des entiers sur 32 bits. Il utilise mktime et localtime.

    Attention toutefois sur les machines 32 bits, les dates limites utilisables sont de 1904 à 2038. Pour utiliser des dates en dehors de cette plage, il faut s'en remettre aux modules spécialisés comme DateTime.

    Comment connaitre le time depuis une date ( L'inverse de localtime et gmtime) ?

    Licence : Gratuit - 31/05/2011 - Téléchargé x
    Il peut être utile de connaître le time d'une date, c'est l'inverse de time, localtime et gmtime. Cela se fait par exemple en php pour les connaisseurs via la fonction mktime. Comme d'habitude, il existe un module en Time::Local en perl déjà présent dans le CORE, donc pas besoin d'installation.

    Ce module posséde deux méthodes timelocal et timegm qui renvoient le time. Il faut leur donner 6 informations sous forme de tableau ($sec,$min,$hour,$mday,$mon,$year).

    Attention : $year sera bien l'année classique (avec + 1900), ex : 2007 et $mois sera compris entre 0 et 11 et non entre 1 et 12.

    Nous trouver le time des dates 01/01/2000 et 05/12/2008



    Vous pourrez maintenant jongler avec les tim ... Voir la suite

    Connaitre une date vieille ou futur

    Licence : Gratuit - 31/05/2011 - Téléchargé x
    Exemple de script permettant de connaitre :

    la date d'aujourd'hui
    la date dans 6 jours
    la date 48 jours avant aujourd'hui
    la date 2 ans et 6 mois avant aujourd'hui
    la date de demain

73 éléments

Responsable bénévole de la rubrique Perl : djibril -