IdentifiantMot de passe
Loading...
Mot de passe oublié ?Je m'inscris ! (gratuit)

Perl75 ressources dans cette catégorie

Retrouvez ici tous les meilleurs téléchargements

Perl

Liste des 75 ressources de cette catégorie

    ED for Windows

    Téléchargé 3 fois-
    0
    0
    ED for Windows est un éditeur et un EDI puissant et intelligent. Que vous développiez en Assembleur, C/C++, MATLAB, Progress, PHP, Ruby, VHDL, Cobol, Fortran, Java, Perl, SQL ou un des nombreux autres langages qu'ED supporte, vous serez rapidement impressionné par ses capacités
    Licence : Payant - Publié le 24/06/2011 - Éditeur : getsoft +

    Professional Notepad

    Téléchargé 3 fois-
    0
    0
    Professional Notepad est un outil avancé permettant de voir et éditer du code HTML, CSS, JavaScript, PHP, PERL, SQL, Delphi, C++ ...
    Licence : Payant - Publié le 24/06/2011 - Éditeur : Professional Notepad +

    Perl Studio

    Téléchargé 3 fois-
    0
    0
    Perl Studio est un éditeur Perl avancé pour développer, déboguer et déployer des applications Perl.
    Licence : Payant - Publié le 24/06/2011 - Éditeur : Perl Studio +

    Perl Scripting Tool

    Téléchargé 3 fois-
    0
    0
    Perl Scripting Tool a été créé à la base pour remplacer le Bloc Note de Windows.
    Licence : Payant - Publié le 24/06/2011 - Éditeur : Perl Scripting Tool +

    Comment désinstaller un module ?

    Téléchargé 3 fois-
    0
    0
    Sous Linux ou Mac OS, il n'existe aucun utilitaire permettant de désinstaller un module Perl. Donc, voici un script qui peut vous permet de le faire proprement.
    Licence : Freeware - Publié le 31/05/2011 - Auteur : djibril +

    Comment tester la validité d'une adresse électronique ?

    Téléchargé 3 fois-
    0
    0
    Pour tester la validité d'une adresse électronique, inutile de s'acharner à trouver la bonne expression régulière. Il existe des modules perl le faisant pour nous proprement.

    Voici un exemple de codes utilisant des modules différents Email::Valid et Mail::CheckUser.
    Licence : Freeware - Publié le 31/05/2011 - Auteur : djibril +

    Comment calculer le nombre de jours et/ou semaines entre deux dates ?

    Téléchargé 3 fois-
    0
    0
    Vous souhaitez connaitre le nombre de jours (ou le nombre de semaines) entre deux dates, utilisez le module Date::Calc.
    Licence : Freeware - Publié le 01/07/2011 - Auteur : djibril +

    Fraise

    Téléchargé 3 fois-
    0
    0
    Fraise est basé sur l'éditeur de texte Smultron, dont le créateur a décidé d’arrêter le développement.
    Fraise est toujours gratuit et compatible Mac OS 10.6+.
    Logiciel - Licence : ActiveState Community - Publié le 02/09/2021 - Éditeur : Fraise +

    Comment fusionner plusieurs fichier "csv" en un fichier Excel avec onglets ?

    Téléchargé 3 fois-
    0
    0
    J'ai cherché sur internet pour faire cela mais sans succès. J'ai adapté ce que j'ai trouvé ici et là pour faire ce petit script (Je suis niveau débutant)
    Licence : Non renseignée - Publié le 29/11/2011 - Taille 2 Ko - Auteur : xanthos78 +

    Jed

    Téléchargé 3 fois-
    0
    0
    Jed est un éditeur de texte gratuit pour Unix, VMS, MSDOS, OS/2, BoOS, QNX et Windows9x/NT. Il est utile aussi bien pour écrire un simple email que pour éditer des programmes complexes dans de nombreux langages de programmation.
    Licence : Freeware - Publié le 24/06/2011 - Éditeur : JedSoft +

    Générer un arbre taxonomique sous freemind depuis la base NCBI

    Téléchargé 2 fois-
    0
    0
    Petit script pour générer le fichier freemind contenant les taxons indiqués en paramètre...

    Il faut une base mysql en local avec les données du NCBI .
    http://linnaeus.zoology.gla.ac.uk/~rpage/tbmap/downloads/ncbi/
    Licence : GPL - Publié le 04/08/2015 - Auteur : extenbrisadlucem +

    Gedit

    Téléchargé 2 fois-
    0
    0
    Gedit est l'éditeur de texte officiel de l'environnement GNOME.
    Licence : Freeware - Publié le 24/06/2011 - Éditeur : GNOME +

    TextPad

    Téléchargé 2 fois-
    0
    0
    Textpad est un éditeur de texte édité par Helios Software Solutions, disponible pour Microsoft Windows.
    Licence : Freeware - Publié le 24/06/2011 - Éditeur : TextPad +

    Kephra

    Téléchargé 2 fois-
    0
    0
    Ce projet a pour but de créer l'éditeur de texte de vos rêves pour écrire, coder, faire des scripts ...
    Licence : Freeware - Publié le 24/06/2011 - Éditeur : kephra.sourceforge.net +

    Vim

    Téléchargé 2 fois-
    0
    0
    Vim est un éditeur de texte, c'est-à-dire un logiciel permettant la manipulation de fichiers texte. Il est directement inspiré de vi (un éditeur très répandu sur les systèmes d'exploitation de type UNIX), dont il est le clone le plus populaire. Son nom signifie d'ailleurs Vi IMproved, que l'on peut traduire par « VI aMélioré », ou éventuellement « VI Meilleur ».
    Licence : Freeware - Publié le 23/11/2011 - Éditeur : vim +

    Comment faire un sleep de moins d'une seconde ?

    Téléchargé 2 fois-
    0
    0
    Pour faire un sleep de moins d'une seconde, il est recommandé d'utiliser le module Time::HiRes qui est disponible dans le core.
    Mais vous pouvez être encore beaucoup plus précis. A vous de jouer avec ce module très puissant.
    Licence : Freeware - Publié le 31/05/2011 - Auteur : djibril +

    Comment raboter un texte trop long et ajouter 3 petits points ?

    Téléchargé 2 fois-
    0
    0
    Comment raboter un texte trop long et ajouter 3 petits points ?
    Licence : Freeware - Publié le 31/05/2011 - Auteur : vil-farfadet +

    Comment récupérer (proprement) les séquences d'un fichier fasta ?

    Téléchargé 2 fois-
    0
    0
    Le but est de récupérer les identifiants et leur séquence une à une de façon simple et rapide grâce au module Bio::SeqIO. Fichier d'entrées :
    test.txt

    >A1
    GATACCAGCATCGTACGTCGTACGTACGTAGGGATCATTATGCCACATTCTGATCTTGGACCTGCATTATAGATCTGACTT
    >A2
    TACCACCCGATCTCGCATCGTCATGTGCGGGATCATTATGCACATTCTGATCTTGGACCTGCATTATAGATCTGACTT
    >B1
    GATACCAGCGGGATCATTATGCCACATTCTGATCTTGGACCTGATAGATCTGACT
    >B2
    GATACCAGCCACTTCTGACGATCGATCGATATTATAAAAGGATCATTATGCCACATTCTGATCgTGGACCTGCATTATAGATCTGCCCTT
    >C1
    GATACCAGCGGGATCATTATGCCACATTCTGATCTTGGACCTGCATTATAGATCTGACTT
    >C2
    GATACCAGCGGGATCCTTATGCCACATTCTGATCTTGGACCTGCATTATAGATCTGACTT

    Résultat

    >A1
    GATACCAGCATCGTACGTCGTACGTACGTAGGGA ... Voir la suite
    Licence : Freeware - Publié le 31/05/2011 - Auteur : Jasmine80 +

    Est-il possible de récupérer des sous-séquences d'un alignement ?

    Téléchargé 2 fois-
    0
    0
    Le module Bio::AlignIO permet de récupérer et d'analyser les séquences une à une en gardant les positions des gaps. On peut donc aussi récupérer un bloc de sous-séquences en gardant leur alignement, mais également obtenir la séquence consensuelle de cet alignement.

    file.fsa

    >A1/1-60
    GATACCAGCGGGATCATTATGCCACATTCTGATCTTGGACCTGCATTATAGATCTGACTT
    .
    >A2/1-57
    ..TACCAGCGGGATCATTATGC.ACATTCTGATCTTGGACCTGCATTATAGATCTGACTT
    .
    >B1/1-55
    GATACCAGCGGGATCATTATGCCACATTCTGATCTTGGACCTG....ATAGATCTGACT.
    .
    >C1/1-60
    GATACCAGCGGGATCATTATGCCACATTCTGATCTTGGACCTGCATTATAGATCTGACTT
    .
    >C2/1-60
    GATACCAGCGGGATCCTTATGCCACATTCTGATCTTGGACCTGCATTATAGATCTGACTT
    .
    >B2/1-61
    GAT ... Voir la suite
    Licence : Freeware - Publié le 31/05/2011 - Auteur : Jasmine80 +

    Comment transposer un fichier tabulé ?

    Téléchargé 2 fois-
    0
    0
    Si vous souhaitez transposer un fichier tabulé, c'est à dire que les lignes de votre fichier deviennent des colonnes, voici une procédure qui peut vous aider.
    Licence : Freeware - Publié le 31/05/2011 - Auteur : djibril +