Est-il possible de récupérer des sous-séquences d'un alignement ?

Présentation
Le module Bio::AlignIO permet de récupérer et d'analyser les séquences une à une en gardant les positions des gaps. On peut donc aussi récupérer un bloc de sous-séquences en gardant leur alignement, mais également obtenir la séquence consensuelle de cet alignement.

file.fsa

>A1/1-60
GATACCAGCGGGATCATTATGCCACATTCTGATCTTGGACCTGCATTATAGATCTGACTT
.
>A2/1-57
..TACCAGCGGGATCATTATGC.ACATTCTGATCTTGGACCTGCATTATAGATCTGACTT
.
>B1/1-55
GATACCAGCGGGATCATTATGCCACATTCTGATCTTGGACCTG....ATAGATCTGACT.
.
>C1/1-60
GATACCAGCGGGATCATTATGCCACATTCTGATCTTGGACCTGCATTATAGATCTGACTT
.
>C2/1-60
GATACCAGCGGGATCCTTATGCCACATTCTGATCTTGGACCTGCATTATAGATCTGACTT
.
>B2/1-61
GATACCAGCCGGATCATTATGCCACATTCTGATCGTGGACCTGCATTATAGATCTGCCCT
T



Résultat

sequence consensus à 50%
GATACCAGCGGGATCATTATGCCACATTCTGATCTTGGACCTGCATTATAGATCTGACTT?

GGGATCATTATGCCACATTCTGATCTTGGACCTGCA
GGGATCATTATGC.ACATTCTGATCTTGGACCTGCA
GGGATCATTATGCCACATTCTGATCTTGGACCTG..
GGGATCATTATGCCACATTCTGATCTTGGACCTGCA
GGGATCCTTATGCCACATTCTGATCTTGGACCTGCA
CGGATCATTATGCCACATTCTGATCGTGGACCTGCA
Téléchargement
Compatibilité
Linux Mac Windows
0  0 
Détails
Catégories : Bioinformatique
Avatar de Jasmine80
Membre émérite
Voir tous les téléchargements de l'auteur
Licence : Freeware
Date de mise en ligne : 31 mai 2011





 
Developpez.com décline toute responsabilité quant à l'utilisation des différents éléments téléchargés.