IdentifiantMot de passe
Loading...
Mot de passe oublié ?Je m'inscris ! (gratuit)

Codes sources Perl31 ressources dans cette catégorie

Les codes sources Perl téléchargeables. N'hésitez pas en rajouter.

Codes sources Perl

Liste des 31 ressources de cette catégorie

    Comment récupérer une date aléatoire entre deux dates données ?

    Téléchargé 2 fois-
    0
    0
    Comme DateTime est le module préconisé, mais qu'il n'est pas disponible dans le Core, alors que POSIX l'est, il me semble que c'est une bonne alternative pour des utilisations "limitées".

    Le code ci-dessous est compatible avec des machines acceptant des entiers sur 32 bits. Il utilise mktime et localtime.

    Attention toutefois sur les machines 32 bits, les dates limites utilisables sont de 1904 à 2038. Pour utiliser des dates en dehors de cette plage, il faut s'en remettre aux modules spécialisés comme DateTime.
    Licence : Freeware - Publié le 31/05/2011 - Auteur : Philou67430 +

    Comment fusionner plusieurs classeurs Excel d'un répertoire en un unique fichier ?

    Téléchargé 2 fois-
    0
    0
    Ce code vous permettra de fusionner plusieurs classeur Excel (xls, xlsx) en un unique fichier Excel (xls). Il copie toutes les feuilles des différents classeurs dans un seul fichier. Le seul inconvénient est qu'il ne garde pas les noms des feuilles mais en génère automatiquement (feuille1, 2, 3, ...) et les formats des cellules ne sont pas conservés.

    Vous aurez besoin d'installer les modules

    Spreadsheet::ParseExcel
    Spreadsheet::XLSX
    Spreadsheet::WriteExcel

    Les modules Getopt::Long et Pod::Usage sont dans le core de Perl.



    Pour savoir comment lancer le programme, faites

    perl nom_programme.pl -help

    ou

    perl nom_programme.pl -man
    Licence : Freeware - Publié le 31/05/2011 - Auteur : djibril +

    Comment transposer un fichier tabulé ?

    Téléchargé 2 fois-
    0
    0
    Si vous souhaitez transposer un fichier tabulé, c'est à dire que les lignes de votre fichier deviennent des colonnes, voici une procédure qui peut vous aider.
    Licence : Freeware - Publié le 31/05/2011 - Auteur : djibril +

    Est-il possible de récupérer des sous-séquences d'un alignement ?

    Téléchargé 2 fois-
    0
    0
    Le module Bio::AlignIO permet de récupérer et d'analyser les séquences une à une en gardant les positions des gaps. On peut donc aussi récupérer un bloc de sous-séquences en gardant leur alignement, mais également obtenir la séquence consensuelle de cet alignement.

    file.fsa

    >A1/1-60
    GATACCAGCGGGATCATTATGCCACATTCTGATCTTGGACCTGCATTATAGATCTGACTT
    .
    >A2/1-57
    ..TACCAGCGGGATCATTATGC.ACATTCTGATCTTGGACCTGCATTATAGATCTGACTT
    .
    >B1/1-55
    GATACCAGCGGGATCATTATGCCACATTCTGATCTTGGACCTG....ATAGATCTGACT.
    .
    >C1/1-60
    GATACCAGCGGGATCATTATGCCACATTCTGATCTTGGACCTGCATTATAGATCTGACTT
    .
    >C2/1-60
    GATACCAGCGGGATCCTTATGCCACATTCTGATCTTGGACCTGCATTATAGATCTGACTT
    .
    >B2/1-61
    GAT ... Voir la suite
    Licence : Freeware - Publié le 31/05/2011 - Auteur : Jasmine80 +

    Comment récupérer (proprement) les séquences d'un fichier fasta ?

    Téléchargé 2 fois-
    0
    0
    Le but est de récupérer les identifiants et leur séquence une à une de façon simple et rapide grâce au module Bio::SeqIO. Fichier d'entrées :
    test.txt

    >A1
    GATACCAGCATCGTACGTCGTACGTACGTAGGGATCATTATGCCACATTCTGATCTTGGACCTGCATTATAGATCTGACTT
    >A2
    TACCACCCGATCTCGCATCGTCATGTGCGGGATCATTATGCACATTCTGATCTTGGACCTGCATTATAGATCTGACTT
    >B1
    GATACCAGCGGGATCATTATGCCACATTCTGATCTTGGACCTGATAGATCTGACT
    >B2
    GATACCAGCCACTTCTGACGATCGATCGATATTATAAAAGGATCATTATGCCACATTCTGATCgTGGACCTGCATTATAGATCTGCCCTT
    >C1
    GATACCAGCGGGATCATTATGCCACATTCTGATCTTGGACCTGCATTATAGATCTGACTT
    >C2
    GATACCAGCGGGATCCTTATGCCACATTCTGATCTTGGACCTGCATTATAGATCTGACTT

    Résultat

    >A1
    GATACCAGCATCGTACGTCGTACGTACGTAGGGA ... Voir la suite
    Licence : Freeware - Publié le 31/05/2011 - Auteur : Jasmine80 +

    Comment tester la validité d'une adresse électronique ?

    Téléchargé 2 fois-
    0
    0
    Pour tester la validité d'une adresse électronique, inutile de s'acharner à trouver la bonne expression régulière. Il existe des modules perl le faisant pour nous proprement.

    Voici un exemple de codes utilisant des modules différents Email::Valid et Mail::CheckUser.
    Licence : Freeware - Publié le 31/05/2011 - Auteur : djibril +

    Comment raboter un texte trop long et ajouter 3 petits points ?

    Téléchargé 2 fois-
    0
    0
    Comment raboter un texte trop long et ajouter 3 petits points ?
    Licence : Freeware - Publié le 31/05/2011 - Auteur : vil-farfadet +

    Comment désinstaller un module ?

    Téléchargé 2 fois-
    0
    0
    Sous Linux ou Mac OS, il n'existe aucun utilitaire permettant de désinstaller un module Perl. Donc, voici un script qui peut vous permet de le faire proprement.
    Licence : Freeware - Publié le 31/05/2011 - Auteur : djibril +

    Comment faire un sleep de moins d'une seconde ?

    Téléchargé 2 fois-
    0
    0
    Pour faire un sleep de moins d'une seconde, il est recommandé d'utiliser le module Time::HiRes qui est disponible dans le core.
    Mais vous pouvez être encore beaucoup plus précis. A vous de jouer avec ce module très puissant.
    Licence : Freeware - Publié le 31/05/2011 - Auteur : djibril +

    script de backup recursif sur FTP avec upload uniquement des fichiers nouveaux ou modifiés

    0
    0
    But: Backup automatique d'un dossier sur un site FTP comme l'hébergement mutualisé OVH.
    - Afin de minimiser les uploads, seuls les fichiers modifiers seront uploader.
    - Comme via ftp on ne peut pas avoir le mtdm (date de derniere modification) pour un dossier, utilisation d'une base de données simple afin de stocker les fichiers avec leur taille et le mtdm local.
    - Comme on ne peut pas accéder la base de donnée directement de l'extérieur par mesure de sécurité, utilisation d'un wrapper HTTP simple utilisant la methode POST.


    Base de donnée et les 2 tables:
    2 tables:
    - backup_folder: pour stocker les chemins globaux des répertoires (et utiliser un id pour la table des fichiers)
    - ... Voir la suite
    Licence : GPL - Publié le 13/08/2014 - Éditeur : ramislebob +

    script de backup recursif sur FTP avec upload uniquement des fichiers nouveaux ou modifiés (sans probleme d'affichage?..)

    0
    0
    But: Backup automatique d'un dossier sur un site FTP comme l'hébergement mutualisé OVH.
    - Afin de minimiser les uploads, seuls les fichiers modifiers seront uploader.
    - Comme via ftp on ne peut pas avoir le mtdm (date de derniere modification) pour un dossier, utilisation d'une base de données simple afin de stocker les fichiers avec leur taille et le mtdm local.
    - Comme on ne peut pas accéder la base de donnée directement de l'extérieur par mesure de sécurité, utilisation d'un wrapper HTTP simple utilisant la methode POST.


    Base de donnée et les 2 tables:
    2 tables:
    - backup_folder: pour stocker les chemins globaux des répertoires (et utiliser un id pour la table des fichiers)
    ... Voir la suite
    Licence : GPL - Publié le 13/08/2014 - Éditeur : ramislebob +