Codes sources Perl

Les codes sources Perl téléchargeables. N'hésitez pas en rajouter.
Ajouter un nouvel élément

    Comment raboter un texte trop long et ajouter 3 petits points ?

    Licence : Freeware - 31/05/2011 - Téléchargé x
    Comment raboter un texte trop long et ajouter 3 petits points ?

    Comment récupérer proprement les arguments de la ligne de commande ?

    Licence : Freeware - 30/06/2011 - Téléchargé x
    Lorsque vous souhaitez appeler vos scripts perl via une console DOS ou Linux (ou Unix), vous avez souvent besoin de passer des arguments. La manière classique pour les récupérer est d'utiliser la variable @ARGV. Sachez qu'il existe un module perl nous permettant de gérer ces arguments proprement et facilement. Ce module est de plus déjà installé dans le core de perl, c'est le module en Getopt::Long. Le code à télécharger ci-dessous nous permet de taper en ligne de commande perl script.pl -name djibril -fichier "C:\repertoire\fichier.txt" -fichier "D:\repertoire\fichier2.txt" -numero 2 -v.

    N.B. : Notez l'importance de protéger le chemin de vos fichiers par des guillemets, surtout s'il y a des espaces. Vo ... Voir la suite

    Convertir un code couleur hexadécimal en RVB ou RGB en Perl

    Licence : Freeware - 23/04/2014 - Téléchargé x
    Voici un code Perl qui permet de convertir un code hexadécimal 3-digits ou 6-digits en code RVB ou RGB (pour les anglais).

    Comment tester la validité d'une adresse électronique ?

    Licence : Freeware - 31/05/2011 - Téléchargé x
    Pour tester la validité d'une adresse électronique, inutile de s'acharner à trouver la bonne expression régulière. Il existe des modules perl le faisant pour nous proprement.

    Voici un exemple de codes utilisant des modules différents Email::Valid et Mail::CheckUser.

    Comment connaitre le nom et l'ip d'une machine en perl ?

    Licence : Freeware - 31/05/2011 - Téléchargé x
    Pas de secret, le CPAN contient ce qu'il faut. Utilisez les modules Sys::Hostname et Socket déjà présent dans le CORE de perl.

    Comment tourner de 90 degrés ou autres toutes les pages d'un fichier au format PDF

    Licence : Freeware - 15/06/2011 - Téléchargé x
    Il peut être utile de devoir tourner un certain nombre de degrés les pages d'un PDF. Hors, tout le monde ne dispose pas d'Adobe Pro ou tout autre logiciel payant pour le faire.
    Voici un programme perl qui le fera pour vous aisément. Il utilise le module PDF::API2.

    Voici le mode d'emploi du programme :
    • perl programme.pl -i input_pdf -o output_pdf -r 90
    • perl programme.pl -i input_pdf -o output_pdf -r 45
    • ...



    script de backup recursif sur FTP avec upload uniquement des fichiers nouveaux ou modifiés

    Éditeur : ramislebob +
    But: Backup automatique d'un dossier sur un site FTP comme l'hébergement mutualisé OVH.
    - Afin de minimiser les uploads, seuls les fichiers modifiers seront uploader.
    - Comme via ftp on ne peut pas avoir le mtdm (date de derniere modification) pour un dossier, utilisation d'une base de données simple afin de stocker les fichiers avec leur taille et le mtdm local.
    - Comme on ne peut pas accéder la base de donnée directement de l'extérieur par mesure de sécurité, utilisation d'un wrapper HTTP simple utilisant la methode POST.


    Base de donnée et les 2 tables:
    2 tables:
    - backup_folder: pour stocker les chemins globaux des répertoires (et utiliser un id pour la table des fichiers)
    - ... Voir la suite

    Comment récupérer (proprement) les séquences d'un fichier fasta ?

    Licence : Freeware - 31/05/2011 - Téléchargé x
    Le but est de récupérer les identifiants et leur séquence une à une de façon simple et rapide grâce au module Bio::SeqIO. Fichier d'entrées :
    test.txt

    >A1
    GATACCAGCATCGTACGTCGTACGTACGTAGGGATCATTATGCCACATTCTGATCTTGGACCTGCATTATAGATCTGACTT
    >A2
    TACCACCCGATCTCGCATCGTCATGTGCGGGATCATTATGCACATTCTGATCTTGGACCTGCATTATAGATCTGACTT
    >B1
    GATACCAGCGGGATCATTATGCCACATTCTGATCTTGGACCTGATAGATCTGACT
    >B2
    GATACCAGCCACTTCTGACGATCGATCGATATTATAAAAGGATCATTATGCCACATTCTGATCgTGGACCTGCATTATAGATCTGCCCTT
    >C1
    GATACCAGCGGGATCATTATGCCACATTCTGATCTTGGACCTGCATTATAGATCTGACTT
    >C2
    GATACCAGCGGGATCCTTATGCCACATTCTGATCTTGGACCTGCATTATAGATCTGACTT

    Résultat

    >A1
    GATACCAGCATCGTACGTCGTACGTACGTAGGGA ... Voir la suite

    Comment récupérer une date aléatoire entre deux dates données ?

    Licence : Freeware - 31/05/2011 - Téléchargé x
    Comme DateTime est le module préconisé, mais qu'il n'est pas disponible dans le Core, alors que POSIX l'est, il me semble que c'est une bonne alternative pour des utilisations "limitées".

    Le code ci-dessous est compatible avec des machines acceptant des entiers sur 32 bits. Il utilise mktime et localtime.

    Attention toutefois sur les machines 32 bits, les dates limites utilisables sont de 1904 à 2038. Pour utiliser des dates en dehors de cette plage, il faut s'en remettre aux modules spécialisés comme DateTime.

    Comment lister les adresses emails d'un fichier

    Licence : Freeware - 30/06/2011 - Téléchargé x
    Ce code vous permet de lire un fichier passé en argument et liste les adresses emails s'y trouvant. Pour lancer ce programme, voici la commande à utiliser :
    perl test.pl -f fichier.txt

    Voilà, que pensez-vous de ce programme, vous a-t-il aidé ?

    script de backup recursif sur FTP avec upload uniquement des fichiers nouveaux ou modifiés (sans probleme d'affichage?..)

    Éditeur : ramislebob +
    But: Backup automatique d'un dossier sur un site FTP comme l'hébergement mutualisé OVH.
    - Afin de minimiser les uploads, seuls les fichiers modifiers seront uploader.
    - Comme via ftp on ne peut pas avoir le mtdm (date de derniere modification) pour un dossier, utilisation d'une base de données simple afin de stocker les fichiers avec leur taille et le mtdm local.
    - Comme on ne peut pas accéder la base de donnée directement de l'extérieur par mesure de sécurité, utilisation d'un wrapper HTTP simple utilisant la methode POST.


    Base de donnée et les 2 tables:
    2 tables:
    - backup_folder: pour stocker les chemins globaux des répertoires (et utiliser un id pour la table des fichiers)
    ... Voir la suite

31 éléments